Hearing health survey of the population in Bangkok.

In this cross-sectional random survey among Thai adults living in Bangkok, we aimed to identify the prevalence of hearing problems and examine their relationship with individual factors. We administered a self-report questionnaire and performed pure-tone air conduction threshold audiometry. A total of 2463 participants (1728 female individuals) aged 15-96 years were included. The hearing loss prevalence was 53.02% and increased with age. The prevalence of a moderate or greater degree of hearing impairment was 2.8%. Participants aged 65 years and over had 8.56 and 6.79 times greater hearing loss and hearing impairment than younger participants, respectively. Male participants were twice as likely to have hearing loss and hearing impairment as female individuals. Participants with higher education levels showed less likelihood of having hearing loss and hearing impairment than those with no or a primary school education. Participants who ever worked under conditions with loud noise for > 8 h per day had 1.56 times greater hearing loss than those without such exposure. An inconsistent correlation was found between hearing loss, hearing impairment and noncommunicable diseases (diabetes, hypertension, and obesity). Although most participants had mild hearing loss, appropriate care and monitoring are necessary to prevent further loss in such individuals. The questionnaire-based survey found only people with hearing problems that affect daily communication.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

MITF variants cause nonsyndromic sensorineural hearing loss with autosomal recessive inheritance.

MITF is a known gene underlying autosomal dominant hearing loss, Waardenburg syndrome (WS). Biallelic MITF mutations have been found associated with a rare hearing loss syndrome consisting eye abnormalities and albinism; and a more severe type of WS whose heterozygous parents were affected with classic WS in both cases. The aims of this study were to identify a new candidate gene causing autosomal recessive nonsyndromic hearing loss (ARNSHL) and confirm its causation by finding additional families affected with the candidate gene and supporting evidences from functional analyses. By using whole exome sequencing, we identified a homozygous c.1022G>A: p.Arg341His variant of MITF, which co-segregated with the hearing loss in five affected children of a consanguineous hearing couple. Targeted exome sequencing in a cohort of 130 NSHL individuals, using our in-house gene panel revealed a second family with c.1021C>T: p.Arg341Cys MITF variant. Functional studies confirmed that the Arg341His and Arg341Cys alleles yielded a normal sized MITF protein, with aberrant cytosolic localization as supported by the molecular model and the reporter assay. In conclusion, we demonstrate MITF as a new cause of ARNSHL, with heterozygous individuals free of symptoms. MITF should be included in clinical testing for NSHL, though it is rare.

Cisplatin-induced ototoxicity in pediatric solid tumors: the role of glutathione S-transferases and megalin genetic polymorphisms.

Cisplatin-induced ototoxicity, an important dose-limiting side effect, has proven high interindividual variability. Glutathione S-transferases (GSTs) are isoenzymes involved in cellular detoxification processes. Megalin has been demonstrated to bind aminoglycosides, known to be similar to cisplatin for their ototoxicity. The GSTs and megalin expression is genetically polymorphic, which might be responsible for the variability in cisplatin-induced ototoxicity. The genotyping of GSTM1, GSTT1 polymorphisms, and 2 nonsynonymous single nucleotide polymorphisms (SNPs) at megalin genes, rs2075252 and rs2228171, were performed in 68 children diagnosed with solid tumors who received cisplatin-based chemotherapy. After the end of treatment, audiometry demonstrated hearing loss in 79.4% of patients according to Brock classification. The cumulative cisplatin dose >400 mg/m is associated with increased risk of cisplatin-induced ototoxicity [odds ratio (OR), 17.5; 95% confidence interval (CI), 3.09-98.62]. GSTT1 wild genotype and C-allele of rs2228171 SNPs of megalin gene occurred with higher frequency in patients with ototoxicity (P=0.023; OR, 10; 95% CI, 1.80-56.00 and P=0.034; OR, 2.67; 95% CI, 1.22-5.82, respectively). In conclusion, our results suggested that GSTT1 wild genotype and C-allele of rs2228171 SNPs might be risk factors for ototoxicity. The cumulative cisplatin dose <400 mg/m should be beneficial in order to ameliorate ototoxicity.

Audiological outcomes of cochlear implantation in Ramathibodi Hospital.

OBJECTIVE: To evaluate the outcomes of the patients at 1-year post cochlear implantation emphasized on audiological outcomes. MATERIALS AND METHOD: Retrospective study of hearing response follow in three, six, and 12 months of 143 ears undergoing cochlear implantation between 1995 and 2009. Only 77 ears were found to have the completed data for analysis. Deaf patients were categorized into five groups in which they were operated by four different cochlear implant devices. The two parameters used to evaluate the outcomes included the aided response (AR), assessing the hearing threshold of cochlear implant user; and the Categories of Auditory Performance (CAP) which assess their auditory receptive abilities. RESULTS: Demographic data showed male:female ratio was 4:3. Age ranged from 2 to 68 years. Although the aided hearing threshold among five groups of deafness showed improvement without statistical difference, the auditory ability showed significance higher score in post-lingual than pre-lingual deaf patients (p < 0.05). Patients with aural communication prior to surgery also showed higher auditory ability than those without aural communication (p < 0.05). The outcomes of CAP were analyzed among patients operated with different cochlear implant devices. Users with Pulsar CI 100 Opus 2, HiRes 90K Auria, and HiRes 90 K Harmony showed better auditory ability than with Combi 40+ Tempo+. Both mean scores of AR and CAP were higher at six and 12 months than at three months. At 12 months the scores were higher than at six months (p < 0.05). CONCLUSIONS: Cochlear implant surgery resulted in good hearing, however the improvement of speech understanding need more time to practice. Patients using cochlear implant at 12 months showed more improvement of hearing and performance than those using for less than 12 months.

Listening and speaking ability of Thai deaf children in preschool aural rehabilitation program.

BACKGROUND: An auditory-oral approach can help deaf children achieve success in oral communication. Many studies confirm that deaf children with access to sound through high-powered and appropriate hearing aids at the youngest age possible have the capability to acquire communication skills similar to their hearingpeers. OBJECTIVE: Evaluate the listening and speaking progress made by 27 Thai hearing-impaired children who attended a preschool aural rehabilitation program, which was established at Audiology and Speech clinic. After hearing aids fitting, deaf children were enrolled to the preschool aural rehabilitation program after receiving their parents consent. MATERIAL AND METHOD: Hearing impaired children were divided into groups of 4-6 children with approximately the same level of performance. The listening and speaking performance at the initial period were recorded. Each group participated in the 3-hour-program once a week, included auditory training, conversation (maternal reflexive method), and speech stimulation. The improvements and problems of each child were recorded at the end of session. Listening and speaking performance evaluation were recorded at six months intervals. RESULTS: There were 12 boys and 15 girls. The average hearing loss in the better ear was 104 dBHL, range from 83-117 dBHL, SD = 8.33. The mean age of enrollment was 2 years and 10 months. The majority gradually developed listening skills and speaking ability. There was no relationship between age of enrollment and the listening and speaking ability (p > 0.05). However, listening skills had positive relationship with length of speech (r = 0.685), number of spoken vocabulary (r = 0.665), and speech character (r = 0.598); p < 0.01. CONCLUSION: Auditory training is an important task to develop listening skills and improve length of speech, speaking vocabulary, and speech character Other benefits from the aural rehabilitation program included monitoring the auditory progression after hearing aid fitting, parents meeting, and promotion a better quality of life by enabling hearing impaired children to participate in hearing society.

Fourteen-years experience with cochlear implantation in Ramathibodi Hospital.

OBJECTIVE: To review the cochlear implant program in Ramathibodi Hospital and share experience of cochlear implantation emphasized on clinical and surgical outcomes. MATERIAL AND METHOD: Retrospective review of 143 ears (140 patients) operated with cochlear implant between 1995 and 2009. The demographic data including etiology of deafness and findings from temporal bone CTscans were reviewed. The authors' experience with cochlear implant surgery in terms of patient selection, patient advisory clinic, necessary equipment, pre- and postoperative evaluations, surgical techniques and complications were discussed. RESULTS: Most congenital origin was unknown etiology and congenital rubella was the most common known cause. From the CT scans of congenital deafness, vestibular aqueduct dilatation was the most common and found in 29.31% while Mondini malformation was shown to be 16.37%. The authors' surgical technique of using the pocket method and designed bony ridge at cortical mastoid rim had helped stabilizing the implant and electrode fancoil. During the last two years, no complication or revision surgery was detected. CONCLUSION: Cochlear implant surgery in both children and adults can result in good surgical outcome and fewer complications under experienced surgeons and a good team.

Otosyphilis: a review of 85 cases.

OBJECTIVE: To review the clinical manifestations and the follow-up hearing results of the treatment modalities in the patients with otosyphilis. STUDY DESIGN AND SETTINGS: A retrospective review between 1984 and 2000 at a university hospital. Patients who presented with cochleovestibular symptoms and were confirmed seropositive for specific treponemal tests were included. Excluded were patients older than 70, or who had other identified causes of cochleovestibular symptoms. RESULTS: Subjects included 56 males and 29 females with an average age of 59.5 years (range, 40 to 70). Common presenting symptoms included hearing loss (90.6%), tinnitus (72.9%), and vertigo (52.9%). The cerebrospinal fluid analysis was positive in 5.4%. The overall respective hearing results in the short- and long-term follow-up were improved or stable in 93.4% and 83.3% of patients. Even though adding steroids and neurosyphilis regimens tended to improve and stabilize hearing, the results were not statistically significant among treatment modalities. CONCLUSION: Further study about hearing outcomes among treatment modalities is suggested.

Indication and surgical consideration of cochlear implantation at Ramathibodi Hospital.

OBJECTIVES: To demonstrate selection criteria for cochlear implant candidates as well as the outcome of quality of life (QoL) after cochlear implant surgery. MATERIAL AND METHOD: Retrospective review was performed of all cochlear implants at Ramathibodi Hospital. A total number of 33 cochlear implantations were performed during the period of 10 years from December 1995 to December 2005. Inclusion criteria were established and the audiological criteria were then evaluated using the electrical promontory stimulation test. The etiology of severe sensory neural hearing loss was detected. The CT scan and MRI of the inner ear were studied in the different causes of deafness. RESULTS: The main cause of deafness in the present study (16 adults and 17 children) was suffering from pregnancy rubella. The second one was familial congenital deafness. The CT scan studied in the rubella cases showed anatomical normal cochlea and the hereditary cause of deafness showed abnormal cochlea that caused a strong perilymphatic gusher in a 14 year- old boy. There were 16 cases of adolescent and adult patients who all had good response in the promontory stimulation test. The QoL post implantation was evaluated in regards to improvement in education and communication. CONCLUSION: Multi-channel cochlear implantation in severe profound hearing loss patients could improve the hearing in both normal and abnormal cochlea, congenital rubella deafness and the familial cause of deafness. The outcomes of the QoL after surgery were better in hearing detection, speech perception, school performance, communication and return to work.

Auditory performance of cochlear implant children aged 2-5 years.

OBJECTIVE: To assess the categories of auditory performance in prelingual deaf children after implantation. STUDY DESIGN: Prospective study MATERIAL AND METHOD: The present study consisted of one boy and four girls aged between 2 and 5 years old at the time of implantation. All subjects had bilateral profound sensorineural hearing loss and received no substantial benefit from amplification. Three subjects were implanted with Med-El combi 40+ with CIS strategy and two subjects received multichanal monopolar Nucleus 24 cochlear implant with ACE strategy. After implantation, all subjects undertook a program ofhabilitation at the Speech and Hearing Clinic Ramathibodi Hospital. The Categories of Auditory Performance (CAP) score was determined at regular intervals prior to implantation, immediately at the initial mapping (0) and 3, 6, 12 and 18 months after the implantation. RESULTS: The results showed that before implantation, only three children showed awareness of environment sounds, CAP score level 1, and that immediately after mapping, all of the children demonstrated awareness of the environmental sounds. Moreover, two of these children showed awareness of speech sounds, CAP score level 2. The CAP scores were gradually increased over a 12-month period. At the 12-month assessment interval, four children could discriminate two speech sounds, CAP score level 4 and one child understood phrases without lip reading, CAP score level 5. 18 months after of implantation, the CAP score for four children increased to level 5. One child understood conversation without lip reading with a familiar talker, CAP score level 6. Furthermore, children with congenital hearing loss who underwent implantation at a younger age received more benefit from the implantation. CONCLUSION: The CAP score was found to be a useful and sensitive tool to evaluate the outcome of auditory receptive abilities in young congenital deaf children who underwent cochlear implantation. The accessible outcome measurement will provide information for parents and professionals to obtain a hierarchical scale on which the children's auditory ability with other more formal measures may be inappropriate.

Aural rehabilitation for deaf children: a northeastern Thailand experience.

Aural rehabilitation for deaf children (hearing loss > 90 dB) has been established since World War II. Many developed countries such as USA, Canada, United Kingdom, Netherlands and Australia have famous institutes providing aural rehabilitation for these children so that they are able to communicate with other people in the hearing society. Teaching programs include auditory training, speech stimulation, speech correction and developing language skills by using natural conversation and real models. In Thailand, the most common mode of communication for deaf children is total communication which focuses on sign language, thus, limiting the ability to communicate with other people. With the realization of this problem, the preschool program for deaf children was set up in 1993 by an audiologist and a speech pathologist at the speech and hearing clinic, Department of Otolaryngology, Faculty of Medicine, Khon Kaen University. A study of 31 deaf children with the average better ear hearing threshold of 103 dB (103.5 +/- 7.01), who visited the program regularly showed that it took an average of 277 days or approximately 9 months (9.25 +/- 4.1) after hearing aid fitting, in acquiring spontaneous meaningful single words or 638 days or approximately 21 months (21.3 +/- 4.3) in acquiring simple conversation or sentences of more than three words. The limitation and problems of the program will be discussed.